Journal: bioRxiv

Article Title: Cellular transformation by combined lineage conversion and oncogene expression

doi: 10.1101/525600

Figure Lengend Snippet: ( A ) Phase contrast microscope images showing the phenotype and morphology of the cells in the course of conversion of fibroblasts to iHeps at different times points after transduction with a cocktail of three TFs HNF1A, HNF4A and FOXA3 ( Huang et al , 2014 ). ( B ) Generation of highly proliferative iHep cells by transducing iHeps with two pools of liver cancer-specific oncogenic drivers, a list of xenograft experiments in nude mice that were used to test the tumorigenicity of different conditions, and mutation rates of the oncogenic drivers as reported in the COSMIC database for HCC and MYC amplification as reported in . CMT pool contains three oncogenes CTNNB1 T41A , MYC, and TERT, and CMT+sg TP53 pool contains the same oncogenes along with constructs for TP53 inactivation by CRISPR-Cas9. Phase contrast microscope images showing the phenotype and morphology of the cells. Oncogenes are co-transduced with fluorescent reporter mCherry for detection of transduced cells. Oncogene transduction to fibroblasts fails to transform the cells, passaging of oncogene-expressing fibroblasts results in cellular senescence as demonstrated by beta-galactosidase staining and loss of mCherry-positive oncogene-expressing cells from the fibroblast population. Passaging of iHeps without oncogenes results in apoptosis after few passages. Scale bar 1000 μm unless otherwise specified.

Article Snippet: Expression construct for mCherry (#36084), lentiviral Cas9 expression construct LentiCas9-Blast (#52962), a cloning backbone lentiGuide-Puro (#52963), and the constructs for neuronal conversion (Tet-O-FUW-Ascl1, #27150; Tet-O-FUW-Brn2, #27151; Tet-O-FUW-Myt1l, #27152; Tet-O-FUW-NeuroD1, # 30129; pTetO-Ngn2-Puro, #52047; Tet-O-FUW-EGFP, # 30130; FUW-M2rtTA, #20342) were obtained from Addgene.

Techniques: Microscopy, Transduction, Mutagenesis, Amplification, Construct, CRISPR, Passaging, Expressing, Staining

Journal: bioRxiv

Article Title: Engineered sex distortion in the global agricultural pest Ceratitis capitata

doi: 10.1101/2020.08.07.240226

Figure Lengend Snippet: A) Schematic representation of the transformation constructs. Cas9 or Cas12a coding sequences are under the transcriptional control of the male germline-specific β2 tubulin promoter (pβ2tub) . The gRNA target sequences are under the control of the endogenous U6 Pol III promoter (pCcU6) and the constitutively expressed DsRed as marker of transgenesis is under the control of the Ubiquitin promoter (pUb) . Gypsy insulator sequences ( gypsy ) are indicated adjacent to pβ2tub and pUb . B) Wildtype red-eye phenotype of an adult male medfly (left) and white-eye phenotype of a female medfly (right). C) The percentage of white-eyed flies obtained by individually crossing hemizygous males expressing Cas9 and the gRNA targeting the white eye gene (Cas9.w) with white-eyed w2Δ/w2Δ females (w) is shown in the top panel. As a control, hemizygous females (Cas9.w) were individually crossed with 10 white-eyed w2Δ/w2Δ males (w). The middle panel, shows the percentage of white-eyed flies obtained by individually crossing hemizygous males expressing Cas12a and the gRNA targeting the white eye gene (Cas12a.w) with white-eyed w2Δ/w2Δ females (w); by crossing hemizygous males for Cas12a.m with white-eyed w2Δ/w2Δ females (w) or by crossing hemizygous Cas12a.m females with w2Δ/w2Δ white-eyed males (w). The bottom panel shows control crosses between wildtype males with white-eyed females from the w2Δ strain (wt x w) and white-eyed males from the w2Δ strain crossed with wildtype females (w x wt). The numbers indicate the total number of individuals scored (N). D) Diagram representation of the autosomal white eye gene of Ceratitis capitata , spanning six exons, and the sequence of the gRNA targeting exon 3 (PAM is shown in yellow). Below, the wildtype sequence is aligned to sequences obtained from F1 white-eyed flies, showing the indels induced by CRISPR/Cas9. The deletion spanning exon 2 of the w2Δ white eye mutant strain is indicated.

Article Snippet: To generate the Cas9 constructs, three DNA fragments were amplified: 1) a 1250 bp fragment including the attP site and Ccβ2-tubulin 5’ regulatory region was amplified from p1260 with primers β2-promoterF and β2-promoterR ; 2) the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815 ) using primers F_Cas9 and R_Cas9 ; 3) the 641 bp 3’-UTR of the β2-tubulin gene was isolated from genomic DNA (extracted from a pool of five adult C. capitata males using the Holmes-Bonner protocol) using primers F_3UTR-β2 and R_3UTR-β2 .

Techniques: Transformation Assay, Construct, Marker, Expressing, Sequencing, CRISPR, Mutagenesis

Journal: bioRxiv

Article Title: Engineered sex distortion in the global agricultural pest Ceratitis capitata

doi: 10.1101/2020.08.07.240226

Figure Lengend Snippet: A) Percentage of adult males in the progeny of transgenic males (blue) or females (red) from each transgenic strain crossed to the wild-type. Each strain was assayed over for four consecutive generations. B) Egg-to-adult survival rate of the progeny of transgenic males crossed to wildtype females of the Cas9.1 and Cas9.2 transgenic strains compared to the wildtype. C) A wildtype male (WT), a Cas9.2a hemizygous transgenic male carrying a single autosomal transgene (2a) and a Cas9.2a/Cas9.2c transhemizygote male carrying two autosomal transgenes (2a2c) observed using the RFP filter (top panel) and cold light source (bottom panel). D) Percentage of males in the progeny of males carrying the Cas9.1e/Cas9.2a (1e2a), Cas9.1e/Cas9.2c (1e2c) and Cas9.2a/Cas9.2c (2a2c) transgenes crossed to wildtype females, compared to a wildtype cross (WT). The numbers indicate the total number of individuals scored.

Article Snippet: To generate the Cas9 constructs, three DNA fragments were amplified: 1) a 1250 bp fragment including the attP site and Ccβ2-tubulin 5’ regulatory region was amplified from p1260 with primers β2-promoterF and β2-promoterR ; 2) the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815 ) using primers F_Cas9 and R_Cas9 ; 3) the 641 bp 3’-UTR of the β2-tubulin gene was isolated from genomic DNA (extracted from a pool of five adult C. capitata males using the Holmes-Bonner protocol) using primers F_3UTR-β2 and R_3UTR-β2 .

Techniques: Transgenic Assay

Journal: bioRxiv

Article Title: Engineered sex distortion in the global agricultural pest Ceratitis capitata

doi: 10.1101/2020.08.07.240226

Figure Lengend Snippet: A) Distribution of selected kmers in the EgII_Ccap3.2.1 genome assembly. For each of the top six longest scaffolds in the EgII_Ccap3.2.1 genome assembly contig CQ is shown and the position of the kmer hits from either all redkmer output (grey), the top25 selected kmers (pink) and for the four experimentally verified sgRNAs (Cas9.1 in green; Cas9.2 in purple; Cas12a.1 in red; Cas12a.2 in blue). B) Organization of the Cas9.1 targeted repeat region. C ) Organization of the Cas9.2 targeted repeat region. D) The medfly genomic repeatome and the distribution of repeats associated with the ~85kb and ~270kb regions targeted by Cas9.1 and Cas9.2, respectively.

Article Snippet: To generate the Cas9 constructs, three DNA fragments were amplified: 1) a 1250 bp fragment including the attP site and Ccβ2-tubulin 5’ regulatory region was amplified from p1260 with primers β2-promoterF and β2-promoterR ; 2) the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815 ) using primers F_Cas9 and R_Cas9 ; 3) the 641 bp 3’-UTR of the β2-tubulin gene was isolated from genomic DNA (extracted from a pool of five adult C. capitata males using the Holmes-Bonner protocol) using primers F_3UTR-β2 and R_3UTR-β2 .

Techniques:

Journal: eLife

Article Title: RNA Polymerase II transcription independent of TBP in murine embryonic stem cells

doi: 10.7554/eLife.83810

Figure Lengend Snippet:

Article Snippet: Transfected construct ( Mus musculus ) , pCas9-mCherry-TRF2-2 , This paper; backbone: cat #64324 (Addgene) , , Targets Tbpl1 for knockout - see Materials and Methods.

Techniques: Knock-In, Knock-Out, Transfection, Construct, Expressing, Plasmid Preparation, Western Blot, Sequencing, Recombinant

Journal: Advanced Science

Article Title: The Non‐Coding Regulatory Variant rs2863002 at chr11p11.2 Increases Neuroblastoma Risk by Affecting HSD17B12 Expression and Lipid Metabolism

doi: 10.1002/advs.202415181

Figure Lengend Snippet: The rs2863002 SNP alters the binding site for the transcription factor GATA3. A) The graph shows the combined results of the TF motifs enrichment analysis (‐Log10P, y‐axis) and the FABIAN scores related to the alteration of the TF binding motifs due to rs2863002 (FABIAN, x‐axis). Each dot represents a TF binding motif with color and size related to the score obtained with the FABIAN prediction tool, while the dotted lines represent the threshold values chosen to classify TF motif disruption (red) or gain (blue). B) ChIP‐seq tracks for GATA3 TF obtained from neuroblastoma cell lines. The image shows rs2863002 at chr11:43 714 768 (hg19/GRCh37) in correspondence with in‐house generated (dark blue) and publicly available (light blue) GATA3 ChIP‐seq data from neuroblastoma cell lines deposited in the GEO database. Data ranges are shown on the left, while neuroblastoma cell lines are reported on the right. C) Chromatin fold enrichment obtained in GATA3 ChIP qPCR experiments carried out in SH‐SY5Y and NMB cells. We report the chromatin fold enrichment obtained for a negative (chr5:24682868–24682979) and a positive (chr2:15982438–15982518) control region for GATA3 binding, respectively in blue and violet, and for the genomic region of rs2863002 in pink. Enrichment measurements are folded on Rabbit IgG and represent the mean ±SD from three independent experiments. D) Chromatin fold enrichment obtained in GATA3 ChIP qPCR experiments carried out in SK‐N‐BE(2) wild‐type cells and relative CRISPR/cas9 edited clones (clone#1, #2, and #3). We report the chromatin fold enrichment obtained for a negative and a positive DNA control region for GATA3 binding, and for the genomic region of rs2863002, as in (B). ns not significant; * p ‐value < 0.05; ** p ‐value < 0.01; *** p ‐value < 0.001. p ‐values were calculated by t ‐test.

Article Snippet: [ ] In brief, a guide RNA (gRNA, 5′‐GATTGATTAAAAGCAACGAT‐3′) was designed using the CRISPOR Tool ( http://crispor.tefor.net/ ) and cloned into a pSpCas9(BB)‐2A‐GFP (PX458) vector expressing Cas9 (Addgene).

Techniques: Binding Assay, Disruption, ChIP-sequencing, Generated, ChIP-qPCR, Control, CRISPR, Clone Assay

Journal: Advanced Science

Article Title: The Non‐Coding Regulatory Variant rs2863002 at chr11p11.2 Increases Neuroblastoma Risk by Affecting HSD17B12 Expression and Lipid Metabolism

doi: 10.1002/advs.202415181

Figure Lengend Snippet: The rs2863002 SNP acts as an enhancer in neuroblastoma cells, positively influencing HSD17B12 expression. A) Luciferase reporter gene assays were carried out in the SH‐SY5Y, SH‐EP, and HEK293 cell lines. Luciferase activity of the constructs harboring the C and T alleles of rs2863002 was compared to a PGL3 empty control vector. The results are expressed as relative luminescence units (RLU) and the ratio between firefly/renilla luciferases provided the normalized luciferase activity for each vector. Data represent the mean ± SD of three independent experiments and p ‐values were obtained by t ‐test. B,C) Violin plots showing the median expression of HSD17B12 according to rs2863002 genotypes in adrenal gland tissue (GTEx portal) (B), and in the TARGET database of neuroblastoma patients (C). D) Hi‐C results obtained in SK‐N‐BE(2)C neuroblastoma cell line, showing the genomic region including rs2863002 on genome assembly hg19/GRCh37. The interaction matrix is centered on rs2863002 at chr11:43 714 768 and extended of 0.4 Mb up‐ and down‐stream. Genomic coverage is 500Kb and the matrix resolution is 10Kb. Red triangles represent the Topologically Associated Domains (TADs). The genomic tracks displayed from top to bottom are: the arcs track showing the interactions between rs2863002 and the up‐stream annotated bins; the normalized number of interactions; the minus Log10 of the FDR adjusted p ‐values; the NCBI RefSeq genes. A brown‐bordered rectangle highlights the HSD17B12 locus. E) Representative western blot image of HSD17B12 expression in SK‐N‐BE(2) wild‐type and CRISPR/Cas9‐edited clones. β‐Actin protein level was used as the loading control. F,G) Quantitative measurements of HSD17B12 protein (F) and mRNA (G) expression in SK‐N‐BE(2) wild‐type and CRISPR/Cas9‐edited clones. H) Correlation analysis of HSD17B12 and GATA3 expression from R2 Genomics ( GSE62564 ). R, correlation coefficient; P, p ‐value. I) Western blot images of GATA3 and HSD17B12 protein levels after 72 h of GATA3 siRNA transfection in SH‐SY5Y, NMB, and SK‐N‐BE(2)C. ns non‐significant; * p ‐value < 0.05; ** p ‐value < 0.01; *** p ‐value < 0.001. p ‐values were calculated by t ‐test.

Article Snippet: [ ] In brief, a guide RNA (gRNA, 5′‐GATTGATTAAAAGCAACGAT‐3′) was designed using the CRISPOR Tool ( http://crispor.tefor.net/ ) and cloned into a pSpCas9(BB)‐2A‐GFP (PX458) vector expressing Cas9 (Addgene).

Techniques: Expressing, Luciferase, Activity Assay, Construct, Control, Plasmid Preparation, Hi-C, Western Blot, CRISPR, Clone Assay, Transfection

Journal: Advanced Science

Article Title: The Non‐Coding Regulatory Variant rs2863002 at chr11p11.2 Increases Neuroblastoma Risk by Affecting HSD17B12 Expression and Lipid Metabolism

doi: 10.1002/advs.202415181

Figure Lengend Snippet: HSD17B12 is an oncogenic driver enhancing cell growth and invasion in neuroblastoma. A,B) HSD17B12 efficient silencing was measured by western blot (A) and qRT‐PCR (B) in SH‐SY5Y and NMB neuroblastoma cell lines 72 h post siRNA transfection. Data represent the mean ±SD from three independent experiments. C,D) Assessment of cell proliferation in SH‐SY5Y and NMB cell lines after silencing of HSD17B12 (C) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (clone#1, #2, and #3) (D). Cell viability measurements were performed using MTT assays at 0, 24, 48, and 72 h post siRNA transfection (C) or after seeding (D). Data shown are the mean ±SD from two independent MTT experiments, with six technical replicates for each experimental point. E,F) Representative images of trans‐well invasion assays performed in SH‐SY5Y and NMB cell lines after silencing of HSD17B12 (E) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (clone#1, #2, and #3) (F). G,H) Number of invasive cells as measured in SH‐SY5Y and NMB silenced cell lines (G) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (clone#1, #2, and #3) (H). Data represent the mean ±SD from two independent experiments. * p ‐value < 0.05; ** p ‐value < 0.01; *** p ‐value < 0.001. p ‐values obtained by t ‐test.

Article Snippet: [ ] In brief, a guide RNA (gRNA, 5′‐GATTGATTAAAAGCAACGAT‐3′) was designed using the CRISPOR Tool ( http://crispor.tefor.net/ ) and cloned into a pSpCas9(BB)‐2A‐GFP (PX458) vector expressing Cas9 (Addgene).

Techniques: Western Blot, Quantitative RT-PCR, Transfection, CRISPR, Clone Assay

Journal: Advanced Science

Article Title: The Non‐Coding Regulatory Variant rs2863002 at chr11p11.2 Increases Neuroblastoma Risk by Affecting HSD17B12 Expression and Lipid Metabolism

doi: 10.1002/advs.202415181

Figure Lengend Snippet: Down‐regulation of HSD17B12 alters lipid molecules affecting the fluidity of membranes and lipid droplet properties. A,B) Membrane fluidity was assessed by measuring the ratio of pyrene‐decanoic acid (PDA) excimer to monomer fluorescence in SH‐SY5Y and SK‐N‐BE(2)C cells after silencing of HSD17B12 (A) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (clone#1, #2, and #3) (B). Fluorescence was evaluated at 400 nm for monomers and 470 nm for excimers. Data represent the mean ± SD of the measurements compared with control conditions (siScrambled) in (A) and SK‐N‐BE(2) wild type in (B) each from two independent experiments performed in duplicate. C,D) Representative confocal images of neutral lipid staining by LipidTOX Green (green) in SH‐SY5Y and SK‐N‐BE(2)C cells after silencing of HSD17B12 (C) and in SK‐N‐BE(2) wild‐type cells and edited clones (D). Nuclei were counterstained with DRAQ5 (blue). Scale bar 20 µM. E,F) Quantification of lipid droplet number obtained through cell‐by‐cell measurements in SH‐SY5Y and SK‐N‐BE(2)C cells after silencing of HSD17B12 (E) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (F). Data represent the mean number ± SD of lipid droplets per cell; measurements have been performed on a mean number of 100 cells per experimental condition. * p ‐value < 0.05; ** p ‐value < 0.01. p ‐values were calculated by t ‐test.

Article Snippet: [ ] In brief, a guide RNA (gRNA, 5′‐GATTGATTAAAAGCAACGAT‐3′) was designed using the CRISPOR Tool ( http://crispor.tefor.net/ ) and cloned into a pSpCas9(BB)‐2A‐GFP (PX458) vector expressing Cas9 (Addgene).

Techniques: Membrane, Fluorescence, CRISPR, Clone Assay, Control, Staining

Journal: Cells

Article Title: Assessment of the Level of Accumulation of the dIFN Protein Integrated by the Knock-In Method into the Region of the Histone H3.3 Gene of Arabidopsis thaliana

doi: 10.3390/cells10082137

Figure Lengend Snippet: PCR analysis of the obtained cell lines, confirming the integration of the target gene into the target region of the HTR5 gene. ( a ) The location of primers for testing using the pIFN(H3.3).2 construct as an example: P1—P-NOS-promoter of A. tumefaciens nopaline synthase gene; nptII —gene of neomycin phosphotransferase II, which provides plant cell resistance to kanamycin; P2—CaMV35S promoter of the cauliflower mosaic virus; S—DNA sequence encoding the leader signal of the carrot extensin gene, which ensures the transport of deltaferon to the apoplast; dIFN—DNA sequence encoding the target protein deltaferon; GST—DNA sequence encoding the GST tag; sgRNA—20 bp Cas9 endonuclease recognition sites, identical to the recognition site in the intergenic region upstream of the A. thaliana HTR5 gene, for excision of the construct from the plasmid in the cell. At the bottom, the names of the oligonucleotides used and the size of the PCR fragments obtained with them are indicated. ( b – d ) Electrophoresis of PCR products of cell lines produced with the pIFN(H3.3).2 construct. ( b ) PCR with primers for the nptII gene (lanes 1–4; the size of the expected fragment is 487 bp) and for the dIFN gene (lanes 5–8; the size of the expected fragment 478 bp). ( c ) PCR with primers for the target insertion into the region of the HTR5 gene (lanes 1–4—with primers Up_H3.3/Lo_plan3 (630 bp) and lanes 5–8—with primers Up_H3.3.1/Lo_plan3 (1048 bp)). ( d ) PCR with primers for the target insertion into the region of the HTR5 gene with primers Up_H3.3.1/Lo_plan3 (1048 bp). Cell line numbers are indicated above the gel lanes. Cell lines 1.1–1.4 and 6.2–6.3 are knock-ins. Lane M is a 1 kb DNA fragment length marker (SibEnzyme, Novosibirsk, Russia). ( e – g ) Electrophoresis of PCR products of cell lines produced with pIFN(H3.3).3 construct. ( e ) PCR with primers Up_H3.3/Lo_plan3 (1048 bp) for the target insertion into the region of the HTR5 gene. ( f ) PCR with primers Up_H3.3/Lo_plan3 (630 bp) for the target insertion into the region of the HTR5 gene. ( g ) PCR with primers npt1 and npt2 for the nptII gene (487 bp). Cell line numbers are indicated above the gel lanes. Cell lines 38.3, 38.29 and 4.10 are knock-ins. Cell lines 10 and 51 have random insertion of the transgene constructs pIFN(H3.3).2 and pIFN(H3.3).3 correspondingly. Lane n.t. is non-transgenic A. thaliana (negative control 1). Lane 0 is non-template DNA (negative control 2). Lane M is a DNA fragment length marker (GeneRuler Express DNA Ladder; Thermo Fisher, Lenexa, KS, USA).

Article Snippet: The plasmids pBlu/gRNA (#59188) for an intermediate cloning step and Cas9 MDC123 (#59184) with the Cas9 endonuclease gene under the control of the 2 × 35S CaMV promoter optimized for expression in Glycine max cells were donated by R. Stupar [ ] from the Addgene repository.

Techniques: Construct, Virus, Sequencing, Plasmid Preparation, Electrophoresis, Produced, Marker, Transgenic Assay, Negative Control

Journal: Nature Communications

Article Title: Cre-Controlled CRISPR mutagenesis provides fast and easy conditional gene inactivation in zebrafish

doi: 10.1038/s41467-021-21427-6

Figure Lengend Snippet: a Scheme of the 3C rationale. A Cre effector construct controls the expression of a floxed Stop cassette upstream of the sequence encoding a fusion protein of Cas9 and GFP. In addition, a U6a promoter drives the constitutive expression of a gRNA targeting a gene of interest (GOI). Following exogenous or transgenic Cre supply, site-specific recombination results in the expression of Cas9-GFP. Combined with the gRNA a functional CRISPR complex is formed and mutates the target site within the gene of interest. b Scheme of the 3C gene inactivation construct targeting tyrosinase ( tyr ). The temperature-inducible hsp70l promotor drives expression of a floxed DsRed cassette. c Identification of transgenic animals expressing DsRed at 50 hpf after a heat treatment at 24 hpf. Example shown is a representative of a total of >100 heat-treated clutches from four independent 3C tyr transgenic insertions. Scale bar: 1000 µm.

Article Snippet: The fragment was subsequently ligated into pTol hsp70l:loxP-DsRed-GFP digested with SmaI and NheI replacing GFP and giving rise to pTol hsp70l:loxP-DsRed-loxP-Cas9-GFP (addgene #158962).

Techniques: Construct, Expressing, Sequencing, Transgenic Assay, Functional Assay, CRISPR

Journal: Journal of experimental & clinical cancer research : CR

Article Title: Palmitoyltransferase ZDHHC6 promotes colon tumorigenesis by targeting PPARγ-driven lipid biosynthesis via regulating lipidome metabolic reprogramming.

doi: 10.1186/s13046-024-03154-0

Figure Lengend Snippet: Fig. 1 Identification of potential genes implicated in colorectal cancer (CRC) and cancer metabolism-associated biological processes. (A) A screening procedure to find putative gene candidates. (B) Colorectal cancer (CRC) samples were found to differ from adjacent controls in terms of physiopathology and biological processes related to metabolism in a number of databases, including TCGA, ICGC, and the NCBI Gene Expression Omnibus (GEO) datasets (GEO: GSE254054, GSE231943, GSE252858, GSE234804, GSE236678, GSE231436, GSE197088, and GSE239549). (C) Following gene differential expression analysis, the total number of differentially expressed genes that crossed over into various databases was counted. (D) Six upregulated and four down regulated DEGs were identified based on a survival analysis of differentially expressed genes across six databases.In the databases of TCGA and ICGC, P < 0.05 was deemed statistically significant. (E) Six upregulated and four downregulated DEGs represent the molecular mechanisms impacting the onset of colorectal cancer and metabolic reprogramming. (F) Palmitoyltransferase ZDHHC6 expression in the ICGC and TCGA databases. (G) Pancarcinoma analysis using TCGA datasets to measure ZDHHC6 expression levels in various malignancies. (H) The overall survival (OS) of colorectal cancer patients in the TCGA and ICGC databases according to different ZDHHC6 expression levels. (I) After dividing the TCGA and ICGC samples’ ZDHHC6 expression levels into groups of high and low expression levels, the grouped samples underwent GSEA analysis. The data were expressed as the mean ± SEM. A P value less than 0.05 was considered statistically significant. ***P < 0.001

Article Snippet: The readymade CRISPR/Cas9 KO products for human ZDHHC6 plasmid (#sc-418298) and PPARγ plasmid (#sc-400030) were acquired from Santa Cruz Biotechnology, Inc.

Techniques: Gene Expression, Quantitative Proteomics, Expressing

Journal: Journal of experimental & clinical cancer research : CR

Article Title: Palmitoyltransferase ZDHHC6 promotes colon tumorigenesis by targeting PPARγ-driven lipid biosynthesis via regulating lipidome metabolic reprogramming.

doi: 10.1186/s13046-024-03154-0

Figure Lengend Snippet: Fig. 2 Increased ZDHHC6 is positively associated with the development of human colorectal cancer (CRC). (A) ZDHHC6 mRNA expression levels in 73 pairs of CRC sample pairs (T) and their corresponding adjacent sample pairs (N). n = 73 pairs. (B) ZDHHC6 protein expression levels in sixteen pairs of similar adjacent tissues and colorectal cancer tissues selected at random. For each group, n = 3. (C) ZDHHC6 mRNA expression levels in relation to a range of CRC-associated cell lines, such as SNU-C2A, SW48, HT-29, LS1034, HCT116, and Caco-2, as well as the matching human normal colonic epithelial cell line (FHC), are displayed in qPCR analysis. For each group, n = 5. (D, E) ZDHHC6 protein expression in SNU-C2A, SW48, HT-29, LS1034, HCT116, Caco-2, and FHC cell line as demonstrated by western blotting (D) and immunofluorescence analysis (E). 200 μm; each group has n = 5. (F, G) qPCR analysis (F) and western blotting experiment (G) demonstrate the effect of the gradually increased dosage of 2-bromopalmitate (2-BP) on the relative ZDHHC6 mRNA and protein expression levels in HCT116, SNU-C2A, SW48, and Caco-2 cell lines. For each group, n = 3. (H) An immunofluorescence assay demonstrating the co-expression of ZDHHC6 and Ki67 in response to 40 µM 2-bromopalmitate (2-BP) in HCT116, SNU-C2A, SW48, and Caco-2 cell lines. 200 μm; each group has n = 3. Data are expressed as mean ± SEM. The relevant experiments presented in this section were performed independently at least three times. P < 0.05 indicates statistical significance

Article Snippet: The readymade CRISPR/Cas9 KO products for human ZDHHC6 plasmid (#sc-418298) and PPARγ plasmid (#sc-400030) were acquired from Santa Cruz Biotechnology, Inc.

Techniques: Expressing, Western Blot, Immunofluorescence

Journal: Journal of experimental & clinical cancer research : CR

Article Title: Palmitoyltransferase ZDHHC6 promotes colon tumorigenesis by targeting PPARγ-driven lipid biosynthesis via regulating lipidome metabolic reprogramming.

doi: 10.1186/s13046-024-03154-0

Figure Lengend Snippet: Fig. 4 ZDHHC6 facilitates lipid deposition and carcinogenesis in CRC cells. (A) A venn diagram shows the variations in metabolites produced by HCT116 cells with ZDHHC6 knockout (KO) and wild-type (WT) phenotypes. ZDHHC6 and fatty acid synthesis pathways have a significant association, according to pathway enrichment analysis of the 36 metabolites. Total peak area was used to correct the LC-MS-based untargeted metabolomic study and its findings. (B) Using these 36 differential metabolites, pathway analysis showed enhanced signaling pathways. (www.metaboanalyst.ca). (C) A heatmap showing how these 36 significantly altered metabolites changed. Student’s t-test, unpaired, two-tailed, P < 0.05. The fold change is indicated by -2.0 ~ 2.0 (Fc). (D, E) The ratios of various isotopic forms of FFA C16:0 (palmitate) in ZDHHC6 (KO) (D) and AdZDHHC6 (E) HCT116 cells after a brief exposure to glucose [U-13C]. When the cell density was around 85%, the media was changed to RPMI 1640 containing 2 g/L glucose tagged with [U-13C]. Following a 24-hour period, the PBS-rinsed cell culture plates were quickly frozen in liquid nitrogen and subjected to an LC-MS assay analysis (n = 4 per group). (F) Representative im munofluorescence pictures of HCT116 cells with ZDHHC6 (WT) and ZDHHC6 (KO) phenotypic, demonstrating ZDHHC6 expression, lipid accumulation (Bodipy staining), and corresponding intracellular triglyceride (TG) levels (n = 4 per group). (G, H) ZDHHC6 (WT) and ZDHHC6 (KO) HCT116 cells were injected into the right flanks of nude mice. Every two days, tumor volumes were measured. On day 22 following dissection, tumor pictures (G), growth curves, and weight (H) were recorded (n = 4 per group). Scale bars, 1 cm. (I) A heatmap utilizing untargeted metabolomic analysis comparing significantly changed metabolites between tumors originating from ZDHHC6 (KO) HCT116 cells and ZDHHC6 (WT) cell lines. Data are expressed as mean ± SEM. The relevant experiments presented in this part were performed independently at least three times. P < 0.05 indicates statistical significance

Article Snippet: The readymade CRISPR/Cas9 KO products for human ZDHHC6 plasmid (#sc-418298) and PPARγ plasmid (#sc-400030) were acquired from Santa Cruz Biotechnology, Inc.

Techniques: Produced, Knock-Out, Liquid Chromatography with Mass Spectroscopy, Protein-Protein interactions, Two Tailed Test, Cell Culture, Expressing, Staining, Injection, Dissection

Journal: Journal of experimental & clinical cancer research : CR

Article Title: Palmitoyltransferase ZDHHC6 promotes colon tumorigenesis by targeting PPARγ-driven lipid biosynthesis via regulating lipidome metabolic reprogramming.

doi: 10.1186/s13046-024-03154-0

Figure Lengend Snippet: Fig. 5 ZDHHC6 specifically binds to the lipid metabolism key transcription factor of PPARγ. (A) After 24 h of SFB-ZDHHC6 transfection in HCT116 cells, ZDHHC6-interacting proteins were identified by tandem affinity purification and mass spectrometry (MS). This was accomplished by removing S-protein, Flag, and streptavidin binding peptide (SFB). (B) ZDHHC6 or IgG antibodies were used to immunoprecipitate HCT116 cell lysates, and PPARγ, PPARα, PPARδ, SREBP1, and ZDHHC6 antibodies were used for western blotting experiments. (C) ZDHHC6 or IgG antibodies were used to immunoprecipitate cellular lysates of SNU-C2A, SW48, HT-29, LS1034, and Caco-2 cells, and ZDHHC6 or PPARγ antibodies were used for western blotting experiments. (D) GST pulldown assay using GST-PPARγ and purified His-ZDHHC6 in HCT116 cells. (E) Schematic of the experimental procedure showing the genes expression in HCT116, Caco-2, SNU-C2A and HT-29 after adenovirus-mediated ZDHHC6 overactivation (AdZDHHC6). The lower schematic diagram showing the inter section of the results from the proteomics and IP-MS analyses. (F) For a duration of 24 h, plasmids expressing Flag-PPARγ or Myc-ZDHHC6 individually or in combination were transfected into HCT116, Caco-2, SNU-C2A and HT-29 cells, respectively. His or Flag antibodies were used for immunoblotting after cellular lysates had been immunoprecipitated with Flag and/or His antibodies. (G) GST pulldown assay using GST-PPARγ and purified Flag-ZDHHC6 in Caco-2 and SNU-C2A cells, respectively. (H) Assay for immunofluorescence staining demonstrating ZDHHC6 and PPARγ co-expression in HCT116, Caco-2, and SNU-C2A cells. 20 μm. (I) In HCT116 cells, vectors containing the hinge-LBD domain, full length (FL), AF-1, DBD, and PPARγ were co-expressed with SFB-ZDHHC6. S-bead pulldown was used to immunoprecipitate cellular lysates. (J) Based on GSEA signaling pathway analysis, an assay of the TCGA-CRC and ICGC-CRC datasets showed a significant connection between ZDHHC6 and the PPARγ pathway in CRC. Data are expressed as mean ± SEM. The rel evant experiments presented in this part were performed independently at least three times. P < 0.05 indicates statistical significance

Article Snippet: The readymade CRISPR/Cas9 KO products for human ZDHHC6 plasmid (#sc-418298) and PPARγ plasmid (#sc-400030) were acquired from Santa Cruz Biotechnology, Inc.

Techniques: Transfection, Affinity Purification, Mass Spectrometry, Binding Assay, Western Blot, GST Pulldown Assay, Purification, Expressing, Protein-Protein interactions, Immunoprecipitation, Immunofluorescence, Staining

Journal: Journal of experimental & clinical cancer research : CR

Article Title: Palmitoyltransferase ZDHHC6 promotes colon tumorigenesis by targeting PPARγ-driven lipid biosynthesis via regulating lipidome metabolic reprogramming.

doi: 10.1186/s13046-024-03154-0

Figure Lengend Snippet: Fig. 6 Identification of the palmitoylation site on PPARγ at evolutionarily conserved cysteine residues. (A) For a duration of 24 h, HCT116 cells were exposed to 60 µM 2-BP, 1 µM ABD957, 6 µM palmostatin B (Palm B), and 10 µM palmostatin M (Palm M) treatments. The slices that were fixed underwent immunofluorescence labeling using PPARγ (red) and pan-palmitoylation (green). 10 μm scale bars; n = 5 per group. (B) Schematic diagram of the Click-iT assay for palmitoylation measurement of PPARγ. HCT116 cells were treated with 100 µM Click-iT PA and azides for five hours. The resulting lysates were then submitted to Click-iT detection as per the product instructions, and PPARγ antibody western blotting analysis was performed. The indicated group’s expression of PPARγ is indicated by the western blotting bands on the right. (C) Using the GPS-Palm program (MacOS_20200219) (The CUCKOO Work group, http://gpspalm.biocuckoo.cn/) and the MDD-Palm algorithm (http://csb.cse.yzu.edu.tw/MDDPalm/), the palmitoylation site on PPARγ in Homo sapiens (upper) and Mus musculus (lower) is predicted to be located. PPARγ’s lower palmitoylation site contains conserved cysteine residues shared by Rattus norvegicus, Bos taurus, Canis familiaris, Mus musculus, and Homo sapiens. (D) After incubating Click-iT PA and azides for five hours on HCT116 cells overexpressing either PPARγ WT or PPARγ C313S mutant, the corresponding cellular lysates were obtained and Click-iT detection was performed in com pliance with the product’s instructions. After the palmitoylated proteins were added to the streptavidin-sepharose bead conjugate for pull-down detec tion, PPARγ and ACTIN antibodies were used in a western blotting examination. While PPARγ C313S was not palmitoylated in top gel, lane 6, or the control groups, it was for PPARγ WT in lane 5. Three separate runs of this experiment were conducted. (E) CHX was cultured with HCT116 cells overexpressing either the PPARγ WT or PPARγ C313S mutant for a specific amount of time. PPARγ and ACTIN antibodies were used in immunoblotting detection of the obtained cellular lysates. The relative PPARγ remaining ratio (n = 4 per group) is displayed in the right curve graph at the specified time point. (F) PPARγ WT or PPARγ C313S mutant overexpression was observed in the upper HCT116 cells. Pan-palmitoylation (green) and PPARγ (red) immunofluorescent label ing were applied to the cell sections. Lower, AdZDHHC6 + PPARγ C313S mutant or PPARγ C313S alone were overexpressed in HCT116 cells, respectively. The bar graph displays the intensity of PPARγ fluorescence in each of the indicated groups (n = 5 pictures; P < 0.05 vs. PPARγ C313S + AdControl or PPARγ WT). Scale bars, 20 μm. (G) In HCT116 cells, PPARγ-Flag and ZDHHC6-HA plasmids were transfected. Alk16 labeling was used to determine the palmi toylated PPARγ expression contents in the presence or absence of hydroxylamine therapy. (H) PPARγ-Flag was used to transfect SNU-C2A cells (WT) or ZDHHC6-deleted SNU-C2A cells, and Alk16 was used to label the cells. Subcellular fraction was extracted, and the levels of PPARγ protein were adjusted to verify that the input cells from the wild type and the knockout cell had the same quantity of PPARγ. Immunoblotting analysis was used to evaluate the palmitoylated PPARγ expression contents in the cell membrane (Mem.), cell cytoplasm (Cyto.), and cell nucleus (Nuc.) components. Data are expressed as mean ± SEM. The relevant experiments presented in this part were performed independently at least three times. P < 0.05 indicates statistical significance

Article Snippet: The readymade CRISPR/Cas9 KO products for human ZDHHC6 plasmid (#sc-418298) and PPARγ plasmid (#sc-400030) were acquired from Santa Cruz Biotechnology, Inc.

Techniques: Immunofluorescence, Labeling, Western Blot, Expressing, Mutagenesis, Control, Cell Culture, Over Expression, Fluorescence, Transfection, Knock-Out, Membrane

Journal: Journal of experimental & clinical cancer research : CR

Article Title: Palmitoyltransferase ZDHHC6 promotes colon tumorigenesis by targeting PPARγ-driven lipid biosynthesis via regulating lipidome metabolic reprogramming.

doi: 10.1186/s13046-024-03154-0

Figure Lengend Snippet: Fig. 7 ZDHHC6-mediated palmitoylated PPARγ enhances its nucleus translocalization. (A) ZDHHC6 and PPARγ expression were examined in the ZDH HC6-deleted HCT116, SNU-C2A and SW48 cells, respectively (n = 3 per group). (B) ZDHHC6 and PPARγ co-expression in AdshZDHHC6-transfected HCT116 cells, along with the matching fluorescence density as determined by Pearson’s analysis (n = 4 per group; P < 0.05 vs. AdshRNA). The scale bars are 20 μm. (C) In ZDHHC6-deleted HCT116 or ZDHHC6-deleted SW48 cells, palmitoylation levels and PPARγ expression were analyzed using western blotting assay (n = 4 per group). (D) Western blotting assay using PPARγ, ACTIN, and HA antibodies, followed by PPARγ overexpressing the HA-tagged ZDHHC6 construct in various CRC cell lines (n = 3 per group). (E) Immunofluorescence pictures demonstrating the co-expression of PPARγ and ZDHHC6 in ZDHHC6-overex pressed HCT116 cells, together with the matching fluorescence density as determined by Pearson’s analysis (n = 4 per group; P < 0.05 compared to empty vector). The scale bars are 20 μm. (F) HCT116 cells underwent IP of HA after co-transfecting with PPARγ and HA-ZDHHC6. ZDHHC6 and PPARγ Mutual Co-IP shows that endogenous ZDHHC6 and PPARγ bind to each other in HCT116 cells. (G) Using various alkyl-labeled fatty acylation, such as alk-C14, alk- C16, alk-C18, and alk-C20, the palmitoylation of PPARγ in the indicated cells was detected. By using streptavidin bead pulldown to identify acylated PPARγ, an immunoblotting experiment using PPARγ and ACTIN antibodies (n = 6 per group) was performed. (H) To identify acylated PPARγ in SW48, LS1034, and HT-29 cells, the same methodology as in (G) was applied. Following that, the lysates (n = 6 per group) were subjected to western blotting analysis using PPARγ and ACTIN antibodies. (I) Using Click reaction-associated streptavidin pulldown, the palmitoylation levels of Flag-labeled PPARγ WT, PPARγ C313S, PPARγ C156S, PPARγ C176S, and PPARγ C159S mutants were examined. Three individuals per group underwent an immunoblotting experiment using Flag and ACTIN antibodies on the relevant lysates. (J) ZDHHC6-HA and PPARγ-Flag were the vectors used to transfect the HCT116 cells. Using alk-C16 labeling, higher, palmitoylated PPARγ levels were demonstrated in both the presence and absence of hydroxylamine therapy. The corresponding fluorescence density and ACLY and PPARγ co-expression in HCT116 WT or HCT116 ZDHHC6 (KO) cells are depicted in the lower representative immunofluorescence images, which were analyzed using Pearson’s method (n = 5 per group; P < 0.05 vs. WT). The scale bars are 20 μm. (K) After transfecting the HCT116 WT or HCT116 ZDHHC6 (KO) cells with PPARγ-Flag, the cells were labeled with alk-C16. To verify that the wild type and knockout cell components for input had the same quantity of PPARγ, subcellular fraction was obtained and PPARγ protein levels were adjusted. Western blotting analysis was used to assess palmitoylated PPARγ levels in the cell membrane (Mem.), cell cytoplasm (Cyto. ), and cell nucleus (Nuc.) components. Data are expressed as mean ± SEM. The relevant experiments presented in this part were performed independently at least three times. P < 0.05 indicates statistical significance

Article Snippet: The readymade CRISPR/Cas9 KO products for human ZDHHC6 plasmid (#sc-418298) and PPARγ plasmid (#sc-400030) were acquired from Santa Cruz Biotechnology, Inc.

Techniques: Expressing, Transfection, Fluorescence, Western Blot, Construct, Immunofluorescence, Plasmid Preparation, Co-Immunoprecipitation Assay, Labeling, Knock-Out, Membrane

Journal: Journal of experimental & clinical cancer research : CR

Article Title: Palmitoyltransferase ZDHHC6 promotes colon tumorigenesis by targeting PPARγ-driven lipid biosynthesis via regulating lipidome metabolic reprogramming.

doi: 10.1186/s13046-024-03154-0

Figure Lengend Snippet: Fig. 9 ZDHHC6-driven lipid biosynthesis contributes to CRC carcinogen esis by upregulating PPARγ. (A, B) In HCT116-related stable cells (Control, ZDHHC6, and ZDHHC6 + shPPARγ) (A) and HCT116-related stable cells (shControl, shZDHHC6, and shZDHHC6 + PPARγ) (B), the percentages of different isotopomers of FFA C16:0 following exposure to [U-13C] glucose are shown. Each group has n = 5. (C, D) The relative TG content and PPARγ expression abundance in the aforementioned cell lines from (A) and (B) are displayed in representative immunofluorescence pictures. Each group has n = 5. The scale bars are 20 μm. (E) In null mice, right flanks were in jected with ZDHHC6 + shPPARγ, ZDHHC6, and Control, stable cells related to HCT116. Every two days, tumor volumes were measured. Weight and tumor growth curves were measured 22 days following dissection. Each group has n = 5. (F) The right flanks of null mice were injected with shCon trol, shZDHHC6, and shZDHHC6 + PPARγ, stable cells linked to HCT116. Every two days, tumor volumes were measured. Weight and tumor growth curves were measured 22 days following dissection. Each group has n = 5. (G) Kaplan-Meier curves representing the survival analysis based on TCGA CRC prognostic data for ZDHHC6-positive, PPARγ-positive, and ZDHHC6 & PPARγ co-positive patients. (H) Based on the prognosis information from the ICGC CRC database, Kaplan-Meier curves were used to analyze the sur vival of ZDHHC6-positive, PPARγ-positive, and ZDHHC6 & PPARγ co-posi tive patients. Data are expressed as mean ± SEM. The relevant experiments presented in this part were performed independently at least three times. P < 0.05 indicates statistical significance

Article Snippet: The readymade CRISPR/Cas9 KO products for human ZDHHC6 plasmid (#sc-418298) and PPARγ plasmid (#sc-400030) were acquired from Santa Cruz Biotechnology, Inc.

Techniques: Control, Expressing, Immunofluorescence, Dissection, Injection

Journal: Journal of experimental & clinical cancer research : CR

Article Title: Palmitoyltransferase ZDHHC6 promotes colon tumorigenesis by targeting PPARγ-driven lipid biosynthesis via regulating lipidome metabolic reprogramming.

doi: 10.1186/s13046-024-03154-0

Figure Lengend Snippet: Fig. 10 Palmitoylation stabilizes PPARγ by ZDHHC6 via blocking its lysosomal degradation to promotes lipid biosynthesis-associated CRC development. As a palmitoyltransferase enzyme, ZDHHC6 regulates the synthesis of fatty acids. To be more precise, ZDHHC6 directly attaches palmitoyl groups to PPARγ, a protein that controls the expression of genes. By stabilizing PPARγ and blocking its lysosomal degradation, the palmitoylation mechanism triggers the production of ACLY and subsequently leads to the development of lipid buildup-related CRC carcinogenesis

Article Snippet: The readymade CRISPR/Cas9 KO products for human ZDHHC6 plasmid (#sc-418298) and PPARγ plasmid (#sc-400030) were acquired from Santa Cruz Biotechnology, Inc.

Techniques: Blocking Assay, Expressing